Review



2023 addgene  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc 2023 addgene
    2023 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2023+addgene/pDL11c+(Plasmid+%2317833)/pm41412476-57-7-8
    Average 93 stars, based on 11 article reviews
    2023 addgene - by Bioz Stars, 2026-11
    93/100 stars

    Images

    Related Articles

    shRNA:

    Article Title: Subthreshold electric fields bidirectionally modulate neurotransmitter release through axon polarization.
    Article Snippet: .. SOURCE ID pAAV-hSyn-iGluSnFR3-v857-SGZ iGluSnFR3 Aggarwal et al., 2023 Addgene #178330 Synapsin-mRuby Synapsin- mRuby Gift from Timothy Ryan Addgene #187896 pGP-AAV-syn-jGCaMP8f-WPRE jGCaMP8f Zhang et al., 2023 Addgene #162376 pHR-EF1a-Archon1-KGC-EGFP-ER2 Archon1 Piatkevich et al., 2018 Addgene #108425 Ace2-D92N-E199V-mNeonGreen (positively tuned Ace2N-mNeonGren) pAce2NmNeonGreen Abdelfattah et al., 2020 Addgene #129256 Kvβ1 shRNA GCTTGGTCATCACAACCAAACTCTACTGG Kvβ1 shRNA Origine TR710094A Table 1. .. SOURCE ID pAAV-hSyn-iGluSnFR3-v857-SGZ iGluSnFR3 Aggarwal et al., 2023 Addgene #178330 Synapsin-mRuby Synapsin- mRuby Gift from Timothy Ryan Addgene #187896 pGP-AAV-syn-jGCaMP8f-WPRE jGCaMP8f Zhang et al., 2023 Addgene #162376 pHR-EF1a-Archon1-KGC-EGFP-ER2 Archon1 Piatkevich et al., 2018 Addgene #108425 Ace2-D92N-E199V-mNeonGreen (positively tuned Ace2N-mNeonGren) pAce2NmNeonGreen Abdelfattah et al., 2020 Addgene #129256 Kvβ1 shRNA GCTTGGTCATCACAACCAAACTCTACTGG Kvβ1 shRNA Origine TR710094A Table 1.



    Similar Products

    2023 addgene  (Addgene inc)
    93
    Addgene inc 2023 addgene
    2023 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2023+addgene/pDL11c+(Plasmid+%2317833)/pm41412476-57-7-8
    Average 93 stars, based on 1 article reviews
    2023 addgene - by Bioz Stars, 2026-11
    93/100 stars
    		  Buy from Supplier
    2023 n a pcdna3 myc ciita addgene  (Addgene inc)
    93
    Addgene inc 2023 n a pcdna3 myc ciita addgene
    2023 N A Pcdna3 Myc Ciita Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2023+addgene/pcDNA3+myc+CIITA+(P%23808)+(Plasmid+%2314650)/pm38117652-559-112-117
    Average 93 stars, based on 1 article reviews
    2023 n a pcdna3 myc ciita addgene - by Bioz Stars, 2026-11
    93/100 stars
    		  Buy from Supplier
    biophysical research communications 676 2023 42 47 addgene  (Addgene inc)
    91
    Addgene inc biophysical research communications 676 2023 42 47 addgene
    Biophysical Research Communications 676 2023 42 47 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2023+addgene/pCR4-MBII52-probe+(Plasmid+%2367647)/pm37481942-26-24-30
    Average 91 stars, based on 1 article reviews
    biophysical research communications 676 2023 42 47 addgene - by Bioz Stars, 2026-11
    91/100 stars
    		  Buy from Supplier
    addgene bioengineering 2023  (Addgene inc)
    98
    Addgene inc addgene bioengineering 2023
    Addgene Bioengineering 2023, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2023+addgene/psPAX2+(Plasmid+%2312260)/pm37760099-505-22-22
    Average 98 stars, based on 1 article reviews
    addgene bioengineering 2023 - by Bioz Stars, 2026-11
    98/100 stars
    		  Buy from Supplier

    Image Search Results